Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1214 (LINC01214) URS0000759A43_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01214: LINC01214 is a long non-coding RNA (lncRNA) that has been found to be significantly upregulated in most lung cancer cell lines compared to non-tumorigenic cells [PMC7109049]. In a study comparing the expression levels of various lncRNAs in lung cancer cell lines, LINC01214 showed a marked increase in expression [PMC7109049]. Additionally, the study found that the expression of FEZF1-AS1 and LIN00673 was also significantly higher in lung cancer cell lines, while the expression of PCAT6 and LINC01929 was notably lower [PMC7109049]. However, no clear trend was observed for the expression of NUTM2A-AS1 [PMC7109049]. To further investigate the role of LINC01214 in lung adenocarcinoma (LUAD) and genomic instability, researchers analyzed data from the GSE50081 dataset obtained from the GEO database [PMC8965709]. The aim was to explore any correlation between LINC01214 expression and LUAD as well as genomic instability [PMC8965709]. In summary, LINC01214 is an lncRNA that is significantly upregulated in most lung cancer cell lines compared to non-tumorigenic cells. Its role in LUAD and genomic instability is being investigated using data from the GSE50081 dataset obtained from GEO database.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCACUGACUUCAAGAAUGAAGCCGUGGACCCUCACGAUUAACUGACCUCUUCCAUGUUCAAACCAUAUGUAAUUGUAAUUGAAUGGAAGUUAAACAUCUGGAAACCGUUAGGAUUGAAUAGCAAUGAAAGGCAGGAAGCACAAGACUAUGGAAAGUGAUUUUGAACAACCAGGGCGACCUGGAAGCAUACUUCUGGUAGCAAUGGGGACACGGGUCAAAGGGGACUUGAGGUUAUCAGCUUUCAGAAUGAAGACACAUAAUCCCUAUUAGAGUGGAAGACUUAAAAUCGAGUUUGAGACCCACCUUCUGAAACUGCAGGCUCUUGGGAGCCUGAUUUCCGGUGAAGAGUGUUGCUGCUUUGCAUUUUUCACACUUGAACACAGUGAAGAAGAUGAACAUUAAUUAGGAUUAUAGUGCCAUGGAGGCUUACUGUGCUGUGAGAACUCACAAGAAAUAAAAUGCCAUUUCUUUUUUUGGAUGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications