Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1276 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1276 precursor URS0000759940_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1276: MIR1276 is a direct target gene of NF-κB in HeLa and HepG2 cells, and its expression is repressed by NF-κB [PMC7177739]. NF-κB upregulates the expression of CASP9 by directly binding to CASP9, but represses the expressions of MIR1276 and its host gene KLHL25 [PMC7177739]. CASP9 is a true target gene of MIR1276 [PMC7177739]. The level of snRNA U6 expression is used for the normalization of MIR1276 expression [PMC7177739]. TargetScan and DIANA-microT-CDS programs were used to predict the binding of MIR1276 to CASP9 mRNA, and it was confirmed that MIR1276 specifically binds to the 3′UTR of CASP9 [PMC7177739]. The expressions of MIR1276 and its host gene KLHL25 are similar in various cell types [PMC7177739]. NF-κB indirectly enhances CASP9 expression by directly repressing the expression of MIR1276 [PMC7177739]. The regulation between NF-κB, MIR1276, and CASP9 forms a coherent feed-forward loop (FFL) that upregulates the mRNA and protein levels of CASP9 in TNFα-treated cells [PMC7177739].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCCAGCUAGGUAAAGAGCCCUGUGGAGACACCUGGAUUCAGAGAACAUGUCUCCACUGAGCACUUGGGCCUUGAUGGCGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications