v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Ile (anticodon TAT) 3-1 (TRI-TAT3-1) secondary structure diagram

Homo sapiens (human) tRNA-Ile (anticodon TAT) 3-1 (TRI-TAT3-1) URS0000758A62_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUCCAGUGGCGCAAUCGGUUAGCGCGCGGUACUUAUAAUGCCGAGGUUGUGAGUUCAAGCCUCACCUGGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Albula goreensis tRNA-Ile
  2. Anguilla anguilla tRNA-Ile
  3. Callithrix jacchus tRNA-Ile (TAT) (tRNA-Ile-TAT-3-1)
  4. Chlorocebus sabaeus tRNA-Ile (TAT) (tRNA-Ile-TAT-3-1)
  5. Gorilla gorilla gorilla tRNA-Ile (TAT) (tRNA-Ile-TAT-3-1)
  6. Macaca mulatta tRNA-Ile (TAT) (tRNA-Ile-TAT-4-1)
  7. Nomascus leucogenys tRNA-Ile (TAT) (tRNA-Ile-TAT-3-1)
  8. Oreochromis niloticus tRNA-Ile (TAT) (tRNA-Ile-TAT-2 1 to 4)
  9. Pan troglodytes tRNA-Ile (TAT) (tRNA-Ile-TAT-3-1)
  10. Papio anubis tRNA-Ile (TAT) (tRNA-Ile-TAT-3-1)
  11. Pongo abelii tRNA-Ile (TAT) (tRNA-Ile-TAT-3-1)
  12. Xenopus tropicalis tRNA-Ile (TAT) (tRNA-Ile-TAT-2 1 to 25)
 2D structure