v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Arg (anticodon TCT) 2-1 (TRR-TCT2-1) secondary structure diagram

Homo sapiens (human) tRNA-Arg (anticodon TCT) 2-1 (TRR-TCT2-1) URS0000738059_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCUCUGUGGCGCAAUGGAUAGCGCAUUGGACUUCUAAUUCAAAGGUUGUGGGUUCGAAUCCCACCAGAGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Ailuropoda melanoleuca tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  2. Balaenoptera acutorostrata scammoni tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  3. Bos taurus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  4. Callithrix jacchus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  5. Canis lupus familiaris tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  6. Carlito syrichta tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  7. Cavia porcellus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  8. Ceratotherium simum simum tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  9. Chlorocebus sabaeus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  10. Cricetulus griseus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  11. Dipodomys ordii tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  12. Echinops telfairi tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  13. Eptesicus nilssonii tRNA-Arg
  14. Equus caballus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  15. Erinaceus europaeus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  16. Felis catus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  17. Gorilla gorilla gorilla tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  18. Heterocephalus glaber tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  19. Ictidomys tridecemlineatus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  20. Loxodonta africana tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  21. Macaca mulatta tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  22. Microcebus murinus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  23. Monodelphis domestica tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  24. Mus caroli tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  25. Mus musculus castaneus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  26. Mus musculus domesticus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  27. Mus musculus musculus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  28. Mus musculus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-4-1)
  29. Mus pahari tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  30. Mus spretus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  31. Mustela putorius furo tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  32. Myotis lucifugus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  33. Nomascus leucogenys tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  34. Ochotona princeps tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1, tRNA-Arg-TCT-3-2)
  35. Ornithorhynchus anatinus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  36. Oryctolagus cuniculus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  37. Otolemur garnettii tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  38. Ovis aries tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  39. Pan troglodytes tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  40. Papio anubis tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  41. Pongo abelii tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  42. Procavia capensis tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  43. Rattus norvegicus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  44. Saimiri boliviensis boliviensis tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  45. Sarcophilus harrisii tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  46. Sorex araneus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  47. Sus scrofa tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  48. Trichechus manatus latirostris tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  49. Tursiops truncatus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  50. Vicugna pacos tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  51. Xenopus tropicalis tRNA-Arg (TCT) (tRNA-Arg-TCT-8 1 to 16)
 2D structure Publications