v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) RNA component of 7SK nuclear ribonucleoprotein (RN7SK) URS0000734D8F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RN7SK: RN7SK is a non-coding RNA that was investigated in a study involving primary human keratinocytes, which are commonly used as an in vitro model for interfollicular epidermis (IFE) cells [PMC8497571]. The study aimed to confirm that the reduction in epidermal cellularity observed was a direct result of RN7SK-deletion [PMC8497571]. The researchers also identified 13 peaks that overlapped with non-coding RNAs encoding for components of ribonucleoproteins, including RN7SK [PMC5425787]. These ribonucleoproteins are involved in various cellular processes and play important roles in RNA metabolism and regulation [PMC5425787]. The presence of RN7SK among these peaks suggests its involvement in these processes as well [PMC5425787]. Overall, the study provides evidence for the significance of RN7SK and its potential role in regulating epidermal cellularity and cellular processes involving ribonucleoproteins. Further research is needed to fully understand the mechanisms by which RN7SK functions and its implications for cellular biology.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGAUGUGAGGGCGAUCUGGCUGCGACAUCUGUCACCCCAUUGAUCGCCAGGGUUGAUUCGGCUGAUCUGGCUGGCUAGGCGGGUGUCCCCUUCCUCCCUCACCGCUCCAUGUGCGUCCCUCCCGAAGCUGCGCGCUCGGUCGAAGAGGACGACCAUCCCCGAUAGAGGAGGACCGGUCUUCGGUCAAGGGUAUACGAGUAGCUGCGCUCCCCUGCUAGAACCUCCAAACAAGCUCUCAAGGUCCAUUUGUAGGAGAACGUAGGGUAGUCAAGCUUCCAAGACUCCAGACACAUCCAAAUGAGGCGCUGCAUGUGGCAGUCUGCCUUUCUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications