Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 70J (SNORA70J) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 70J (SNORA70J) URS000072EF54_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA70J: SNORA70J is a small nucleolar RNA (snoRNA) that has been studied in the context of ovarian cancer (OC) prognosis prediction. A signature based on nine snoRNAs, including SNORA70J, has been developed to predict the prognosis of OC patients [PMC10001105]. The expression abundance of SNORA70J, as well as its host gene RPSAP71, is found to be very low in ovarian cancer tissues [PMC9119353]. The expression levels of SNORA70J and other snoRNAs (SNORA11B, SNORA36C, SNORA58, SNORA75B, SNORD3C, SNORD89, and SNORD105B) were analyzed using qRT-PCR in clinical tissues and were found to be downregulated in tumor tissues compared to their paired normal tissues [PMC9119353]. Primers for amplifying the expression levels of snoRNAs including SNORA70J were synthesized using a probe method [PMC9119353]. The nine snoRNA signature that includes SNORA70J has been identified as a potential prognostic and therapeutic target for ovarian cancer [PMC10050728].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCAGCCAAUUAAGCCGACUGAGUUCCUUUCCUCAUGGGGGCCCAGUGUGCAAUCGCUGCAAACAGCAGCUUCCUUGGUAGUAUAUGCAGCCUGUUUAUUGUACGGGUUGCUCUACGGGACCUUGGAGACAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications