Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-488 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-488 precursor URS000072C8C2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR488: MIR488 is a microRNA that has been identified among the differentially expressed genes in various studies [PMC4052096]. Leptin treatment has been shown to decrease the levels of MIR488 in mHypoA-POMC/GFP culture [PMC6947463]. There is evidence to suggest that MIR488 may interact with ZIP and modulate MMP-13 activity [PMC3706240]. Additionally, MIR488, along with other microRNAs such as miR30a, miR9, miR1249, and miR497, has been found to inhibit epithelial-mesenchymal transition (EMT) through MAPK signaling [PMC7602903]. A recent study has reported a relationship between MIR488 and ZIP8 in osteoarthritis, where reduced degradation of chondrocytes was observed [PMC3934988]. The roles of zinc uptake transporters like ZIP8 and MIR488 may be crucial in bone health as low bone mineral density is a common symptom of type 1 and type 2 diabetes [PMC3934988]. However, the epigenetic effect of intermittent hypoxia on the amount of MIR488 has not been confirmed yet [PMC3934988]. In Helicobacter pylori-infected gastric cancer tissues, both miR-218 and MIR488 were found to be decreased but there was no significant difference between different H. pylori strains [PMC6365042]. References: - PMC4052096 - PMC6947463 - PMC3706240 - PMC7602903 - PMC3934988 - PMC6365042

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGAAUCAUCUCUCCCAGAUAAUGGCACUCUCAAACAAGUUUCCAAAUUGUUUGAAAGGCUAUUUCUUGGUCAGAUGACUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Gorilla gorilla gorilla microRNA 488 (ENSGGOG00000030802.2)
  2. Gorilla gorilla microRNA mir-488
2D structure Publications