Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 50C (SNORA50C) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 50C (SNORA50C) URS0000726F61_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA50C: SNORA50C is a small nucleolar RNA, H/ACA Box 50C, with an unknown function [PMC6232700]. In neuroblastoma cells, SNHG25 promotes the accumulation of SNORA50C and the assembly of the associated small nucleolar ribonucleoprotein (snoRNP) through pseudouridine synthase 1 (DKC1), which ultimately promotes the growth and migration of neuroblastoma cells [PMC9700476]. The co-occurrence of IQGAP2 genomic alterations and deletions in SNORA50A, SNORA50C, and RNA component of 7SK nuclear ribonucleoprotein (RN7SK) genes is associated with reduced disease-free survival in prostate cancer [PMC7336766]. The co-changes in IQGAP2, SNORA50A, SNORA50C, and RN7SK genes may be developed into a diagnostic tool for prostate cancer recurrence [PMC6232700]. There were no SPOP mutations and copy number variations for SNORA50A, SNORA50C, and RN7SK in the MSKCC cohort [PMC6232700]. In neuroblastoma cells, SNHG25 positively regulates the expression of SNORA50C to stabilize HDAC1 protein and promote neuroblastoma development [PMC9276775]. The interaction between DKC1 and SNHG25 facilitates the accumulation of SNORA50C to stabilize HDAC1 protein in neuroblastoma cells [PMC9276775]. Knockdown of either SNHG25 or SNORA50C leads to increased ubiquitination levels of HDAC1 protein in neuroblastoma cells [PMC9276775]. Overall, these findings suggest that the interaction between DKC1-SNHG25-SNORA50C plays a crucial role in promoting malignant behaviors in neuroblastoma through HDAC1 stabilization.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGCUGUCUUUGAGCCCCCGCCGAGCUUCCUCGUGGCGCCGGGGGUCAAUCUGCAGCGCUAGAGCAUGUGCUUGCGCAUAACUGGGGCCGCCUGGCCUCCCGCGGGCGGCCUUUUUAACCGCGAGCGACAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications