Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-155 precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-155 precursor URS0000723DBB_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-155: Mmu-mir-155 is a type of microRNA that has been studied in various contexts [PMC8387184]. One study found that GLGZD treatment significantly suppressed the upregulation of mmu-mir-155 and increased the expression of SOCS1, SMAD1, SHIP1, and TAB2 mRNA induced by OGD [PMC8387184]. Another study observed that mmu-mir-155 was significantly up-regulated in the mid-phase of infection [PMC3692539]. In terms of miRNA expression analysis, mmu-mir-155 was reverse transcribed from RNA using a Taqman miRNA Reverse Transcription kit [PMC8368181]. These findings suggest that mmu-mir-155 may play a role in various biological processes and could be a potential target for therapeutic interventions [PMC8387184][PMC3692539][PMC8368181]. However, further research is needed to fully understand the functions and mechanisms of mmu-mir-155 in different contexts [PMC8387184][PMC3692539][PMC8368181].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUUAAUGCUAAUUGUGAUAGGGGUUUUGGCCUCUGACUGACUCCUACCUGUUAGCAUUAACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications