Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 47 (SNORA47) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 47 (SNORA47) URS0000723018_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA47: SNORA47 is a type of small nucleolar RNA that has been implicated in the progression of non-small cell lung cancer (NSCLC) [PMC5838311]. Patients with high expression of SNORA47 have been found to have shorter overall survival rates and higher recurrence rates compared to those with low expression [PMC5838311]. In a study using A549 cells, it was observed that these cells were more susceptible to treatment with SNORA47 shRNA [PMC8017274]. This finding led to the selection of A549 cells for further analysis [PMC8017274]. The study also found that knockdown of SNORA47 could inhibit the progression of NSCLC by inhibiting the epithelial-mesenchymal transition (EMT) process and the PI3K/Akt signaling pathway [PMC8017274]. These results suggest that SNORA47 plays a role in promoting NSCLC progression and could be a potential therapeutic target for this type of cancer [PMC8017274].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGGACUGAGAAGGUGAGGCAGUUUUGCCCCGUGCUGCCUUCCACCGGUUAAGACCUCCAAAAUCGAAGGGCUGCCCAGGCAGAGGAUGUCCCCUUGCCACCCUUGGAGGGGCAGCGCUGUGCUGGCCGACAUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications