Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-149 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-149 precursor URS000071F654_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR149: MIR149 is a gene located at 2q37.3, consisting of one exon that codes for MIR149 and exhibits polymorphisms [PMC9956572]. The expression of miR-149 and the EphB3 gene in SW1116 and HCT116 cells is influenced by Form [PMC5983960]. However, the mechanism by which MIR149 regulates the expression of MMP and cyclin D remains unknown, requiring further investigation [PMC5983960].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGGCGCCCGAGCUCUGGCUCCGUGUCUUCACUCCCGUGCUUGUCCGAGGAGGGAGGGAGGGACGGGGGCUGUGCUGGGGCAGCUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications