Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-302c precursor URS000071C6FC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR302C: MIR302C is one of the upregulated genes associated with the inhibition of EC migration and proliferation in ESRD-hiPSC-ECs [PMC8685359]. However, MIR302C is not expressed in pulmonary cells [PMC4125569]. The pathway of GSEA enrichment includes MIR302C and is associated with various cancer-related processes [PMC9130929]. MIR302C expression is induced by JMJD2 demethylase binding in its promoter region and reduces H3K9me2 methylation [PMC4501658]. PRP-1, a cytostatic peptide, downregulates MIR302C targets, including stemness markers Nanog and c-Myc [PMC4501658]. Overexpression of miR302s, including MIR302C, induces massive apoptosis in cancer cell lines [PMC4400607]. MIR302C is part of the miR-302 family that plays a key role in pluripotency and cell reprogramming [PMC4433211]. It is also downregulated in pancreatic cancer and associated with age-related decline [PMC6154866][PMC6046043]. Activation of canonical BMP signaling upregulates miR302b and MIR302C expression [PMC4164941]. The miR-302 cluster includes miR-302b, MIR302C, miR-302a, miR- 02d, and miR367 that are highly expressed in embryonic stem cells but decline after differentiation [PMC6722449][PMC7555329].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUUGCUUUAACAUGGGGGUACCUGCUGUGUGAAACAAAAGUAAGUGCUUCCAUGUUUCAGUGGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Aotus nancymaae microRNA 302c (ENSANAG00000013790.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-302
  3. Carlito syrichta (Philippine tarsier) microRNA 302c (ENSTSYG00000020227.2)
  4. Cercocebus atys (Sooty mangabey) microRNA 302c (ENSCATG00000019168.1)
  5. Chlorocebus sabaeus (African green monkey) microRNA 302c (ENSCSAG00000025588.1)
  6. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000013036.1)
  7. Gorilla gorilla gorilla miRNA (ENSGGOG00000038345.1, ENSGGOG00000043477.1)
  8. Macaca fascicularis (Crab-eating macaque) microRNA 302c (ENSMFAG00000005206.2)
  9. Macaca mulatta microRNA mml-mir-302c precursor
  10. Macaca nemestrina (Pig-tailed macaque) microRNA 302c (ENSMNEG00000017285.1)
  11. Mandrillus leucophaeus (Drill) microRNA 302c (ENSMLEG00000010007.1)
  12. Nomascus leucogenys microRNA 302c (ENSNLEG00000019438.2)
  13. Oryctolagus cuniculus microRNA ocu-mir-302c precursor
  14. Pan paniscus microRNA 302c (ENSPPAG00000020046.1)
  15. Pan troglodytes ptr-mir-302c (ENSPTRG00000027646.2)
  16. Papio anubis (olive baboon) microRNA 302c (ENSPANG00000005330.3)
  17. Piliocolobus tephrosceles miRNA (ENSPTEG00000031429.1)
  18. Pongo abelii (Sumatran orangutan) microRNA mir-302
  19. Pongo pygmaeus microRNA ppy-mir-302c precursor
  20. Rhinopithecus bieti microRNA 302c (ENSRBIG00000018563.1)
  21. Rhinopithecus roxellana microRNA 302c (ENSRROG00000027517.1)
  22. Saimiri boliviensis boliviensis microRNA 302c (ENSSBOG00000006329.1)
  23. Sciurus vulgaris (Eurasian red squirrel) microRNA 302c (ENSSVLG00005025977.1)
  24. Theropithecus gelada microRNA 302c (ENSTGEG00000003935.1)
Publications