Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 9 (SNORD9) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 9 (SNORD9) URS000071BC75_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD9: SNORD9 is a small nucleolar RNA C/D Box 9 that is found to have high connectivity in coexpression networks, suggesting its potential role in the development and progression of liver hepatocellular carcinoma (LIHC) [PMC7235675]. In addition to SNORD9, other genes with high connectivity in these networks include CRHBP, CLEC1B, GDF2, and OR5L2 [PMC7235675]. SNORD9 is also among the top downregulated genes involved in membrane depolarization during cardiac muscle cell action potential [PMC10046396]. In the TCGA-LAML study, SNORD9 is one of the genes for which gene expression levels were collected and analyzed [PMC10046396]. Furthermore, SNORD9 is among the upregulated genes in pediatric AML cohort (TARGET-AML) [PMC10046396]. Normalization to endogenous control genes such as SNORD9 was performed to correct for potential RNA input or RT efficiency biases [PMC7801461]. In recognized clusters of genes with common functions, SNORD9 was found to be upregulated along with other small nucleolar RNAs (snRNAs) and downregulated genes involved in cholesterol homeostasis [PMC6839856]. References: - [PMC7235675]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7235675/ - [PMC10046396]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10046396/ - [PMC7801461]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7801461/ - [PMC6839856]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6839856/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCCUGUGAUGAGUUGCCAUGCUAAUACGGAGACACCAGGUAGGGAGUUUUACCCUAACUUGGGUGUUGUUGAAAUAAACUCUUUCUCGUAAAUGCUGAGGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications