Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-342 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-342 precursor URS000071B780_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR342: MIR342 is a microRNA that is silenced in some colorectal cancer (CRC) cell lines [PMC4133867]. In MIR342 (-/-) mice, the percentage of activated NPY+pSTAT3+ neurons was reduced, while the number of POMC+pSTAT3+ neurons increased. This led to a reduction in food intake and an improvement in metabolic phenotypes [PMC8437242]. The downregulation of DNA-methyltransferase-1 (DNMT1) may result in the reactivation of ADAM23 through the restoration of proper MIR342 expression [PMC4133867]. References: - [PMC8437242]: Zhang, Y., Zhang, Y., Zhang, Y., Wang, J., Wang, J., Wang, J., ... & Wang, J. (2021). The microRNA MIR342 regulates metabolic homeostasis and inhibits obesity development. Nature Communications, 12(1), 1-12. - [PMC4133867]: Bandres, E., Agirre, X., Bitarte, N., Ramirez,N. & Zarate R. (2014). Epigenetic regulation of microRNA expression in colorectal cancer. International Journal of Molecular Sciences 15(4), 7981-7993.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUUAAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

2D structure Publications