Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-410 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-410 precursor URS0000717C38_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR410: MIR410, a microRNA, was investigated to determine if it promotes hPAEC apoptosis [PMC6616369]. Previous research has shown that NAMPT promotes resistance to apoptosis [PMC6616369]. In the study, two microRNA genes, MIR155 and MIR410, were identified in the networks and found to be involved in glucose metabolism [PMC8620086].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUACCUGAGAAGAGGUUGUCUGUGAUGAGUUCGCUUUUAUUAAUGACGAAUAUAACACAGAUGGCCUGUUUUCAGUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications