Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 114-2 (SNORD114-2) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 114-2 (SNORD114-2) URS00007165EA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD114-2: SNORD114-2 is a member of the small nucleolar RNA, C/D Box 114 cluster (SNORD114) family [PMC7862201]. In a study comparing omental metastasis (OMTs) to matched primary ovarian cancer tissues (POCTs), the expression of SNORD114-2 was found to be decreased in OMTs [PMC8497990]. Another study also showed that SNORD114-2 was downregulated in omental tissues compared to ovarian cancer tissues [PMC5769367]. Additionally, SNORD114-2 was found to be downregulated in metastatic ovarian cancer compared to primary tumors [PMC8677010]. These findings suggest that the expression of SNORD114-2 may be associated with different types of cancer and could potentially serve as a biomarker for disease progression or prognosis [PMC7862201][PMC8497990][PMC5769367][PMC8677010]. Further research is needed to fully understand the role and significance of SNORD114-2 in cancer development and progression [PMC7862201][PMC8497990][PMC5769367][PMC8677010].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGACCAAUGAUAAUGACUGUUGGGGUAUGAGUCAGUGAGGUUGAAUAACAGUUUGUAUCUGGAAAUCUGAGGUCCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications