Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 68 (ENSG00000200084.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 68 (ENSG00000200084.1) URS0000714052_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD68: SNORD68 is a small nucleolar RNA (snoRNA) that is associated with pre-40S complexes [PMC4288182]. RNAi against the 40S biogenesis factor PWP2 only resulted in a minor reduction in pre-40S associated SNORD68 and SNORD56, while depletion of DDX21 led to a significant reduction of SNORD68 and SNORD56 in pre-40S complexes [PMC4288182]. Etoposide treatment was found to increase the levels of SNORD68 and snord111B, which are the guide RNAs for A2388 and G3923 2′-O-methylation, respectively [PMC6451326]. In stem cell and differentiated cells, normalization was performed using the arithmetic mean of three small RNAs (SNORD68, SNORD95, and SNORD96A) that showed very little or no change [PMC7494815]. To estimate miRNA abundance, a primer targeting both mouse and human mature-miR-451a was used along with an SNORD68 primer targeting both mouse and human SNORD68 [PMC9429931].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUGACAUUCUCCGGAAUCGCUGUACGGCCUUGAUGAAAGCACAUUUGAACCCUUUUCCAUCUGAUUGCUGAGGCUUUUCAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications