Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-942 precursor URS0000712C24_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR942: MIR942 is a microRNA molecule that has been studied in various contexts. In blood platelets from patients with NSTEMI, it was found to be one of the most downregulated miRNAs [PMC5155104]. In ovarian cancer, the circular RNA CircEPSTI1 was found to promote cancer progression by inhibiting MIR942 [PMC7479240]. Additionally, upregulation of MIR942 has been associated with sunitinib resistance in patients with metastatic renal cell carcinoma [PMC6917607]. However, there is limited research on MIR942 in the context of ADHD, with only one study found [PMC8077053]. In a different study, two consecutive probes downstream of a top 20 probe for MIR942 reached a significant threshold and were differentially methylated CpGs [PMC9922242]. Furthermore, in two studies based on the GSE94462 dataset, MIR942 was among several microRNAs that were analyzed [PMC9922242]. In another study on obstructive sleep apnea (OSA), the expression of KCNN2 and MIR942 significantly increased as OSA progressed and significantly decreased after treatment [PMC9554663]. Additionally, the expression of KCNN2 and other genes such as PLXNB3 and SERPINA12 were positively correlated with apnea-hypopnea index (AHI) in OSA patients [PMC9554663]. Overall, these studies highlight the potential role of MIR942 in various diseases and conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUAGGAGAGUAUCUUCUCUGUUUUGGCCAUGUGUGUACUCACAGCCCCUCACACAUGGCCGAAACAGAGAAGUUACUUUCCUAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications