Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-657 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-657 precursor URS000070FFCE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-657: Hsa-mir-657 is a microRNA that has been identified as a predictive molecular biomarker for early diagnosis of laryngeal cancer [PMC5642505]. It is highly conserved and has a binding position at 639 [PMC3521223]. Overexpression of hsa-mir-657 has been shown to have high sensitivity and specificity for discriminating between early larynx carcinoma and normal mucosa tissues [PMC4695119]. Hsa-mir-657 is one of three miRNA genes encoded by the introns of the AATYK gene, with its origin after the primate-rodent split [PMC3544654]. It has been demonstrated to be involved in the inhibitory interaction with the 3'-UTR of the IGF2R gene, resulting in allele-specific modulation of IGF2R expression [PMC6275070]. Hsa-mir-657 has also been identified as one of several miRNAs associated with breast neoplasms [PMC9088870]. It is part of a ceRNA network that regulates genes involved in breast cancer, such as WT1 and ETV1 [PMC5710922]. In animal models, hsa-mir-657 has been shown to affect tumor growth when manipulated using mimics or inhibitors [PMC9402383]. Additionally, increased expression of hsa-mir-657 has been associated with inflammatory response in gestational diabetes mellitus and it is one of the most represented miRNAs in all ASD samples [PMC9000903]. Finally, hsa-mir-657 has binding sites on the 3'UTR region of hCYP1A1 gene and its dysregulation may be associated with AD risk factors such as type 2 diabetes and venous thrombosis [PMC5220472][PMC8287568][PMC7279294].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGUAGUAGAGCUAGGAGGAGAGGGUCCUGGAGAAGCGUGGACCGGUCCGGGUGGGUUCCGGCAGGUUCUCACCCUCUCUAGGCCCCAUUCUCCUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications