Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 93 (SNORD93) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 93 (SNORD93) URS0000708227_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD93: SNORD93 is a small nucleolar RNA (snoRNA) that has been characterized as a host transcript [PMC7334372]. It has been reported that SNORD93 plays prognostic predictive roles in breast cancer, SNORA42 in lung cancer, and SNORA21 in colon cancer [PMC8649667]. Interestingly, SNORD93 is unique as it is the only snoRNA that has not been confirmed and reported to have prognostic predictive roles [PMC4378963]. In terms of its genomic distribution, SNORD93 has 92 copies in the tinamou genome, while other vertebrate genomes only have 1-2 copies [PMC4378963]. In a study on clear cell renal cell carcinoma (ccRCC), it was found that the expression levels of SNORA2, SNORD12B, SNORA70B, SNORD93, and SNORD116-2 were positively correlated with their copy number variations (CNVs) [PMC7011154]. Furthermore, the expression of six snoRNAs including SNORD93 was found to be associated with poor survival of patients [PMC8658237].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCCAAGGAUGAGAACUCUAAUCUGAUUUUAUGUGCUUCUGCUGUGAUGGAUUAAAGGAUUUACCUGAGGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications