Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-615 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-615 precursor URS000070789A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR615: MIR615 is a microRNA that has been found to be significantly downregulated in osteosarcoma patient tissues and is correlated with poor clinical outcomes [PMC9441498]. It is located within the HOXC cluster on chromosome 13 and has been implicated in prostate and colon cancer [PMC4620477]. MIR615 encodes two microRNAs, MIR615-5p and MIR615-3p [PMC4620477]. The region encoding MIR615-3p has been targeted using sgRNA expression plasmids in experiments involving colorectal carcinoma cells [PMC4620477]. The epigenetic regulation of MIR615, which is located within a CpG island, is a novel discovery [PMC3037319]. In pancreatic ductal adenocarcinoma (PDAC), MIR615 has been found to be differentially expressed and associated with PDAC progression [PMC10057657]. It has also been associated with CAG length in the meta-analysis of data from PDAC patients [PMC5764268]. In addition, MIR615 has been shown to inhibit cell proliferation, migration, and invasion in vitro [PMC10057657]. Furthermore, it interacts with several protein-coding genes, miRNAs, lncRNAs, rRNAs, and other non-coding RNAs [PMC9730017]. Overall, the dysregulation of MIR615 expression and its interactions with various genes suggest its potential role in cancer development and progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCGGGAGGGGCGGGAGGGGGGUCCCCGGUGCUCGGAUCUCGAGGGUGCUUAUUGUUCGGUCCGAGCCUGGGUCUCCCUCUUCCCCCCAACCCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes miRNA
2D structure Publications