Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 92 (ENSG00000264994.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 92 (ENSG00000264994.1) URS0000706C1B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD92: SNORD92 is a small nucleolar RNA (snoRNA) that is involved in RNA modification processes. It has been found to interact with 28S rRNA and is associated with hypomethylated positions A3846 and C3848 [PMC8522698]. The efficient modification of SNORD92, along with SNORD53 and xtSNORD88, may require additional base-pairing interactions [PMC8522698]. The expression levels of SNORD53B, SNORD92, and SNORD53 vary across different tissues within the SNORD53/92 family [PMC8178906]. SNORD72 has been reported to be upregulated in cancer cells and promote liver cancer cell invasiveness by stabilizing ID2 mRNA, while the expression of SNORD92 has been linked to breast cancer patient outcomes [PMC9803687]. Several snoRNAs, including SNORD99, SNORA11, and SNORD104, have shown significant associations with various clinicopathological features of breast cancer [PMC9803687]. In breast cancer samples, the upregulation of TNBC-associated snoRNAs (SNORD92 and SNOR72) was observed in ER negative and PR negative tumors. Luminal BC-associated snoRNAs (SNORA11 and SNOR104) were associated with ER positive and PR positive tumors [PMC9803687]. Furthermore, changes in the methylation pattern of specific positions in 28S rRNA were accompanied by consistent changes in the expression levels of corresponding snoRNAs including SNOR48, 68, 50A/B, 92, 49A/B [PMC9941101].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCUGUGAUGAUGCCUUAAUAUUGUGGUUUCGACUCACUGAGAGUAAAAUGAGGACCUACAAUUCCUUGGCUGUGUCUGAGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

2D structure Publications