Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 10 (SNORD10) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 10 (SNORD10) URS0000706530_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD10: SNORD10 is a C/D box small nucleolar RNA (snoRNA) that guides the methylation of specific target sites in RNA molecules [PMC5027482]. It forms the first base pair of Helix 71 in domain IV together with C3787, which is also fully methylated [PMC5027482]. The expression of SNORD10 is reduced in hepatocellular carcinoma (HCC) tissues [PMC7093170]. Knockdown of SNORD10 attenuates the growth of gastric cancer cells [PMC8677010]. SNORD10 is one of the 14 nucleolar box C/D snoRNAs that do not vary in abundance between parent and knockdown cells, regardless of whether 2'-O-methylation of their target residue varies or not [PMC8336889]. SNORD10 targets one of the three examples of 2'-O-methylcytidine within spliceosomal RNA U6 [PMC6894857]. The expression levels of SNORD10 are up-regulated in formalin-fixed paraffin-embedded tissues [PMC7812721]. Additionally, SNORD10 has been identified in plasma samples from healthy individuals [PMC5772623].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCUGUGAUGGAGCCCAUGCGUGUCAUCUGAGCCUCUGGCUUCCCUGCCAGUGCAGCCCUGGCAGUGUCCUACUUCCCAGGGCUGUUGUCUGCCUGGCGGGAAGGUCCUGGGCAAAGGAUCAGUCUUUGUACUCUGAGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications