Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 70B (ENSG00000206937.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 70B (ENSG00000206937.1) URS00006FFE91_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA70B: SNORA70B is a small nucleolar RNA (snoRNA) that has been identified as part of a snoRNA signature for the diagnosis and prognosis prediction of renal clear cell carcinoma (ccRCC) [PMC10050728]. In a study conducted on a Turkish dementia cohort, it was found that SNORA70B, along with its host gene USP34, may play significant roles in ccRCC tumorigenesis through the Wnt signaling pathway [PMC7011154]. Additionally, SNORA70B was found to be positively related to CTNNB1 and USP34 was positively related to CTNNB1, MYC, TCF4, and TCF7L2 [PMC7011154]. The expression levels of SNORA70B were found to be positively correlated with its copy number variations in ccRCC [PMC7011154]. Furthermore, previous studies have shown that SNORA70B is abnormally expressed in ccRCC and is associated with poor survival outcomes for patients [PMC7812721] [PMC8658237]. In conclusion, SNORA70B is an important snoRNA involved in the development of ccRCC and may have potential diagnostic and prognostic value for patients with this type of cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCAGCCAAUUAAGCUGACUGAAUUCCUUUCCUUAUGGGGGUCCAGUGUGCAAUGGCUGUAAACAGCAGCUUCCUUGGUAGUGUAUGCGGCCUGUUUGUUGUAUAGGUUGCUCUAAGGGACCUUGGAGACAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications