Homo sapiens microRNA mir-770

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens microRNA mir-770 URS00006F7B40_9606

98 nucleotides
2 databases (GeneCards, MalaCards)
Found in 0 other species
145 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CAGGAGCCACCUUCCGAGCCUCCAGUACCACGUGUCAGGGCCACAUGAGCUGGGCCUCGUGGGCCUGAUGUGGUGCUGGGGCCUCAGGGGUCUGCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 0 other species

Chlorocebus sabaeus microRNA mir-770
Gorilla gorilla gorilla microRNA mir-770
Macaca mulatta microRNA mir-770
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA mir-770
Pan troglodytes (chimpanzee) microRNA mir-770
Papio anubis microRNA mir-770
Pongo abelii (Sumatran orangutan) microRNA mir-770

Publications