Homo sapiens (human) small nucleolar RNA, H/ACA box 7B (SNORA7B)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, H/ACA box 7B (SNORA7B) URS00006F6999_9606

139 nucleotides
9 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, RefSeq, Rfam, snoDB, snOPY)
Found in 0 other species
43 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA7B: SNORA7B is one of the top up-regulated genes in FSGS compared to MCD [PMC4633097]. It has been found to play a role in promoting the growth, proliferation, migration, and invasion of breast cancer cells [PMC6509762].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GACCUCCUGGGAUCGCAUCUGGAGACUGCCUAGUAUUCUGCCAGCUUCGGAAAGGGAGGGAAAGCAAGCCUGGCAGAGGCACCCAUUCCAUUCCCAGCUUGCUCCGUAGCUGGUGAUUGGAAGACACUCUGCGACAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure

Publications