Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-668 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-668 precursor URS00006F5B1B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-668: Hsa-mir-668 is a microRNA that has been studied in various contexts. RT primers and TM primers for hsa-mir-668 were obtained from Applied Biosystem's TaqMan [PMC6208663]. It has been found to interact with the promoter of the AQP4 M1 gene, along with other microRNAs [18 [PMC6208663]. In a specific study, hsa-mir-668 was found to be upregulated, along with hsa-miR-374b-3p, while hsa-miR-370 was downregulated [PMC4222942]. The relationship between hsa-mir-668 and leukemia is uncertain, as it is not clear if it is related to the disease [PMC7929672]. The CD SNP rs7559479 in the IL18RAP locus affects the binding efficiency of hsa-miR-140-3p, hsa-miR-212, and hsa-mir-27a. Another SNP in the same area (rs7603250) affects the binding of hsa-mir-668 [PMC3410018]. Hsa_mir_668 has been identified as one of several microRNAs that can target a validated circRNA called hsa_circRNA_102488 [PMC7063791]. Additionally, it has been found that five survival-associated microRNAs (hsa-miR7705p, hsa_mir_541,hsa_mir_485_3p,hsmiR656,andhsa_mir_668) are encoded in the chromosome 14q32 region [PMC4278335]. HsmiR 154,hsmiR300,hsmiR654,hsmi R665,andhsmIR 668 are not conserved in equids[PM6302407].

MIR668: MIR668 is a conserved vertebrate locus that belongs to a supercluster of many tens of miRNAs [PMC3431481]. In a study investigating the effect of miR185 and MIR668, miR20b was used as a supplement to ensure the same amount of total miRNA in each sample [PMC4591293]. The study also involved cotransfecting luciferase reporter constructs with β-galactosidase plasmid and miR185 and/or MIR668 using Lipofectamine 2000 [PMC4591293]. Another study elucidated the molecular mechanisms of MIR668 in the protection of the kidney during ischemia, suggesting its potential as a therapeutic agent [PMC8001091]. In terms of non-protein coding RNA expression, MIR668 was found to be down-regulated in females but up-regulated in males, along with other snoRNAs, miRNAs, and lncRNAs [PMC7663125]. The reannotation of MIR668 provided evidence for 3'-tailed mirtrons in vertebrates [PMC3431481]. Furthermore, down-regulated expression was observed for MIR668 in various comparison groups [PMC6911042]. References: - PMC4591293 - PMC8001091 - PMC7663125 - PMC3431481 - PMC6911042

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUAAGUGCGCCUCGGGUGAGCAUGCACUUAAUGUGGGUGUAUGUCACUCGGCUCGGCCCACUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

2D structure Publications