Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 42A (ENSG00000238649.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 42A (ENSG00000238649.1) URS00006F0D71_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD42A: SNORD42A is a C/D box small nucleolar RNA (snoRNA) that is expressed in a cell-specific manner, particularly in mammary glands and lymphoblastoid cells [PMC6316884]. It has been reported that SNORD42A, along with other C/D box snoRNAs, is bound by nucleophosmin 1 (NPM1), a phosphoprotein residing in nucleoli [PMC8629011]. SNORD42A plays a role in directing site-specific 2'-O-methylation of 18S ribosomal RNA (rRNA) [PMC8629011]. Functional knockout of SNORD42A has been shown to decrease 18S-U116 methylation and impair colony formation potential and proliferation of acute myeloid leukemia (AML) cell lines [PMC8629011]. SNORD42A is highly expressed in primary AML blasts compared to healthy cells [PMC8629011]. It has been suggested that SNORD42A alters the translation preference of the ribosome by affecting its 3D structure, thereby promoting cell proliferation [PMC8975097]. Deletion or deficiency of SNORD42A inhibits AML cell proliferation and colony-forming ability [PMC9098889] [PMC9256764] [PMC9790134]. Dysregulation of snoRNAs, including SNORD42A, has been observed in AML and other cancers such as ovarian cancer, prostate cancer, colorectal cancer, and non-small cell lung cancer (NSCLC) [PMC9859176] [PM9115109] [PM8742282] [PM7753709] . The exact roles of SNORA69 and SNORD42A in autism spectrum disorder (ASD) are yet to be determined but are promising areas for investigation[ PMC8235321]. Overall, snoRNAs like SNORD42A have been shown to modulate various biological processes and signaling pathways in cancer cells, making them potential therapeutic targets [PMC9005336].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCUAAUGAUGGAAAAAUCAUUAUUGGAAAAGAAUGACAUGAACAAAGGAACCACUGAAGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications