Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-192 precursor URS00006ECF62_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR192: MIR192 is a specific miRNA that has been found to be increased in the renal cortex of diabetic mice compared to control mice [PMC5376412]. It is also considered a biomarker for heart failure, along with miR34a and miR-194, and is released by exosomes [PMC8773242]. These specific miRNAs, including MIR192, are being studied for their potential use in the early diagnosis of hypertrophic cardiomyopathy and heart failure [PMC8773242]. Exosomes are small vesicles that are released by cells and contain various biomolecules, including miRNAs [PMC8773242]. The levels of TGF-β1, p53, and MIR192 were found to be increased in the renal cortex of diabetic mice compared to control mice in a study [PMC5376412]. These findings suggest that MIR192 may play a role in the pathogenesis of diabetes-related renal complications. Additionally, the release of MIR192 by exosomes suggests its potential as a biomarker for heart failure. Further research is needed to fully understand the role of MIR192 in these conditions and its potential as a diagnostic tool.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGAGACCGAGUGCACAGGGCUCUGACCUAUGAAUUGACAGCCAGUGCUCUCGUCUCCCCUCUGGCUGCCAAUUCCAUAGGUCACAGGUAUGUUCGCCUCAAUGCCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Publications