Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U12 small nuclear (RNU12) secondary structure diagram

Homo sapiens (human) RNA, U12 small nuclear (RNU12) URS00006ECA78_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNU12: RNU12 is a non-coding RNA that is associated with various genetic conditions. It is one of the snRNAs, which are small nuclear RNAs that play a role in RNA splicing [PMC7073466]. In a recent study, a mutation in RNU12 was found to be associated with an autosomal recessive spinocerebellar ataxia (SCA) [PMC5815091]. This mutation was detected through the combination of whole-genome sequencing (WGS) and RNA sequencing (RNAseq) analysis in a large consanguineous family [PMC5815091]. The mutation in RNU12 was found to cause minor intron retention in homozygous mutant patients, leading to cerebral ataxia [PMC6497742]. These findings highlight the importance of non-coding RNAs, such as RNU12, in genetic disorders and provide insights into the molecular mechanisms underlying these conditions. Further research is needed to fully understand the role of RNU12 and its potential therapeutic implications for these disorders.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGCCUUAAACUUAUGAGUAAGGAAAAUAACGAUUCGGGGUGACGCCCGAAUCCUCACUGCUAAUGUGAGACGAAUUUUUGAGCGGGUAAAGGUCGCCCUCAAGGUGACCCGCCUACUUUGCGGGAUGCCUGGGAGUUGCGAUCUGCCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications