Homo sapiens U7 small nuclear RNA

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens U7 small nuclear RNA URS00006E7EE5_9606

64 nucleotides
2 databases (GeneCards, Rfam)
Found in 2 other species
4 publications
1. sncRNA
2. snRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAGAGUUACAGCUCUUUUAGAAUUUGUCUGGCAGGCUUUCCAGUUUUUGCCAGUGUGAACCCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Gorilla gorilla gorilla U7 small nuclear RNA
Pan troglodytes (chimpanzee) U7 small nuclear RNA

2D structure

Publications