Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) Small nucleolar RNA SNORA74 (ENSG00000272025.1) secondary structure diagram

Homo sapiens (human) Small nucleolar RNA SNORA74 (ENSG00000272025.1) URS00006E52FE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA74: SNORA74, also known as U19, is an H/ACA box snoRNA that has been implicated in various biological processes. It has been shown to contribute to the regulation of the AKT/mTOR signaling pathway [PMC6539089]. SNORA74 is located in a 400-kb region that also contains protein coding genes CTNNA1, SIL1, and MATR3, as well as other noncoding features such as 5S rRNA, U6 snRNA [PMC4327160]. In patients with chronic lymphocytic leukemia (CLL), decreased expression of SNORA74 has been associated with improved clinical outcomes [PMC9859176]. In a study on retinal development, SNORA74 was found to be upregulated in retinas with oxygen-induced retinopathy (OIR) compared to normoxic retinas [PMC5032015]. Additionally, SNORA74 has been shown to modify the two most conserved pseudouridines (Ψs) on 28S rRNA in higher eukaryotes [PMC6466398]. Interestingly, upregulation of SNORA74 has also been observed in gallbladder cancer [PMC6466398]. Overall, these findings highlight the diverse roles and potential clinical significance of SNORA74 in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAGCAGUCGUUAGCUCUCCUGGCUAGUGUGAUGCCUGUGAUGGUGUUUCACUGUUGGAACAGCAAGCACUGUCUUAAUUGAGGCUUGGCUCCGGGUGCUGUUUUGGUGUGGGGCCAAGUAUACCUUUGGGCAGUGUUUUGCACUUCUGAGAGUGAAAUGACUCCUGUGGAGUCGGUCCUAAUCUGAGUGCAAACAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications