Homo sapiens (human) small nucleolar RNA, C/D box 99 (ENSG00000221539.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 99 (ENSG00000221539.1) URS00006E3D71_9606

74 nucleotides
4 databases (Ensembl, GeneCards, Rfam, snoDB)
Found in 1 other species
41 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD99: SNORD99 is a small nucleolar RNA (snoRNA) that has been used as a reference target in the WaferGen miRNA SmartChip [PMC6308291]. In a study, the correlation of SNORD99 was found to be inverse with certain genes such as SLC44A2, ZNF541, NNMT, ZNF622, and TSPAN10 [PMC8306428]. Interestingly, SNORD99 has been detected in neuron-derived extracellular vesicles (EVs) and was found to be more abundant in exosomes isolated from endothelial cells compared to their cells of origin [PMC8782166]. In another study, decreased levels of SNORD99 were observed in cells overexpressing RBPMSA [PMC9738375]. Overall, SNORD99 is a snoRNA that has been used as a reference target in miRNA analysis and has shown interesting associations with gene expression patterns and EVs.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACUGGUCCAGGAUGAAACCUAAUUUGAGUGGACAUCCAUGGAUGAGAAAUGCGGAUAUGGGACUGAGACCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.