Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-490 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-490 precursor URS00006E154A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR490: MIR490 is a methylated miRNA that has been found in both cell lines and control B cells, as shown by methylation specific PCR (MSP) [PMC5485978]. It is also present in extracellular vesicles (EVs) derived from human periodontal ligament stem cells (hPDLSCs) [PMC7287171]. MIR490, along with MIR335 and MIR296, targets less than 200 genes each [PMC7287171]. In bladder cancer cells, MIR490 acts as a suppressor of cell proliferation by blocking the transcription of FOS [PMC7287171]. It has also been found to inhibit the expression of HMGA2 in osteosarcoma and affect the development potential of the cancer [PMC7287171]. In lung cancer cells A549 and ovarian cancer, MIR490 blocks the transcription of CCND1 and CDK1 respectively, both important genes involved in cell cycle progression [PMC7287171]. The expression of MIR490 can be regulated by CCAT1 in gastric cancer, and its high expression can decrease the expression of CCAT1 and restrain metastasis [PMC9844612]. In multiple myeloma patients, high expression levels of miR153, MIR490, miR455, miR642, miR500, and miR296 are associated with favorable prognosis [PMC6183594]. In lung adenocarcinoma (LUAD), down-regulation of MIR490 is observed while up-regulation of MALAT1 and HMGA2 is observed. The ceRNA network involving MALAT1 as a competing endogenous RNA for MIR490 may contribute to tumor progression in LUAD [PMC7212445]. Overall survival outcomes are poorer in lung cancer patients with lower expression levels of MIR490. Gain- and loss-of-function studies have shown that overexpression of MIR490 reduces proliferation, promotes G1 arrest and apoptosis, and suppresses migration and invasion [PMC7212445].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGGCCUUGCUGGUUUGGAAAGUUCAUUGUUCGACACCAUGGAUCUCCAGGUGGGUCAAGUUUAGAGAUGCACCAACCUGGAGGACUCCAUGCUGUUGAGCUGUUCACAAGCAGCGGACACUUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

2D structure Publications