Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 70F (SNORA70F) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 70F (SNORA70F) URS00006E0411_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA70F: SNORA70F is a small nucleolar RNA (snoRNA) that has been found to be down-regulated in chronic lymphocytic leukemia (CLL) patients with adverse prognostic markers, such as unmutated IGHV, ZAP70 and CD38 positivity, and specific chromosomal abnormalities (del11 and 12+) [PMC3766210]. It is located within the first intron of the COBLL1 gene, and its expression correlates significantly with that of its host gene [PMC3766210]. In CLL patients with trisomy 12 (12+), del11, ZAP-70 positivity, or CD38 positivity, SNORA70F expression is downregulated [PMC9219770]. SNORA70F has also been associated with shorter progression-free survival in CLL patients [PMC8975097]. Additionally, SNORA70F has been included in a 2-snoRNA model that can distinguish different prognostic groups in CLL [PMC6629867]. The functions of SNORA70F and other dysregulated snoRNAs in leukemia are not fully understood but are believed to be involved in the regulation of alternative splicing mRNAs and may serve as potential therapeutic targets for leukemia treatment [PMC8975097].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCAGUCAAUUAAGUGUACUGAGUUCCUUUCCUUAUGGGGGCCCAGUGUGCAAUGGCUGCAAACAGCAGCUUCCUUGGUGGUGUAUGCAGCCUGUUUCCUCUAUAGGUUGCUCUAAGGGACCUUGAUAAUAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications