Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) Small nucleolar RNA SNORD116 (ENSG00000202498.1) secondary structure diagram

Homo sapiens (human) Small nucleolar RNA SNORD116 (ENSG00000202498.1) URS00006D8D58_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD116: SNORD116 is a long non-coding RNA (lncRNA) that plays a role in various biological processes. Deletion of SNORD116 in a mouse model lacking the lncRNA 116HG resulted in increased energy expenditure and dysregulation of circadian genes [PMC7215637]. SNORD116, along with SNORD115 and other snoRNAs, has been implicated in the pathogenesis of Prader-Willi syndrome (PWS) and schizophrenia [PMC6937981]. SETDB1 has been suggested as a potential therapeutic target for PWS treatment by disrupting its function selectively at the SNORD116 locus [PMC7176658]. The expression of Nhlh2 transcript levels was higher in mice lacking SNORD116 expression compared to wild-type mice [PMC9369261]. Deletion encompassing the snoRNAs within the SNORD116 cluster is sufficient to cause PWS [PMC4030979]. The 14q32.2 imprinted locus, which encodes snoRNAs similar to SNORD116, exhibits allele-specific chromatin decondensation in neurons [PMC7917289]. The role of SNORD116 in human energy homeostasis and growth requires further research [PMC7073628]. Transcriptional activation of the SNORD116 gene cluster is not controlled by the PWS-IC center and is not maternally silenced [PMC4742849]. RBFOX2 directly binds to SNORD116 snoRNA, suggesting its involvement in alternative splicing regulation [PMC8573313]. Multiple copies of SNORD116 are distributed within Ipw-A exons in mice [PMC8037846]. Dysregulation of snoRNAs, including SNORD116, has been observed in osteoarthritis and joint aging, suggesting their potential as biomarkers for these conditions [PMC9818347]. In conclusion, deletion or dysregulation of SNORD116 is associated with various physiological and pathological conditions, including energy expenditure, circadian rhythm, PWS, schizophrenia, and osteoarthritis [PMC7215637][PMC6937981][PMC7176658][PMC9369261][PMC4030979][PMC7917289][PMC7073628][PMC4742849][PMC8573313][PMC8037846][PMC9818347].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUCAUUGAUGACUUCCAUAUAUCCAUUCCUUGGAAAGCUGAACAACAUGAGUGAAAACUCUACUGAAAAAAGAAAAGAAAUGGGAGGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications