Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-621 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-621 precursor URS00006D8030_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-621: Hsa-mir-621 is a highly expressed human microRNA found in salivary microvesicles [PMC3422169]. It has been shown to be induced by TP-472 treatment [PMC9323884]. Survival analysis has revealed that up-regulated hsa-mir-621 is associated with a significantly lower overall survival rate [PMC8544338]. Additionally, hsa-mir-621 has been suggested to contribute to the pathogenesis of hypertension in systemic lupus erythematosus (SLE) [PMC7356926]. Hsa-mir-621 has also been identified as one of the hub genes in a study investigating its role in various diseases, including cancer [PMC9851797]. Furthermore, hsa-mir-621 is among the significantly downregulated miRNAs in certain conditions [PMC7292968]. It has also been found to be significantly involved in hepatocellular carcinoma (HCC) [PMC7467934]. In summary, hsa-mir-621 is a highly expressed microRNA that plays a role in various diseases and conditions. It is induced by TP-472 treatment and its up-regulation is associated with lower overall survival rates. Hsa-mir-621 may contribute to the pathogenesis of hypertension in SLE and has been identified as one of the hub genes involved in cancer. Additionally, it can be downregulated under certain conditions and is significantly involved in HCC. These findings highlight the potential importance of hsa-mir-621 as a biomarker or therapeutic target for various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGAUUGAGGAAGGGGCUGAGUGGUAGGCGGUGCUGCUGUGCUCUGAUGAAGACCCAUGUGGCUAGCAACAGCGCUUACCUUUUGUCUCUGGGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications