Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-519c precursor URS00006D6710_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR519C: MIR519C is a placenta-specific miRNA that is produced by trophoblasts and can be released as free miRNA or packaged into extracellular vesicles (EVs) [PMC6460512]. It has been shown to inhibit TNFα gene expression in placental explant models [PMC6460512]. MIR519C is part of the C19MC cluster on chromosome 19, which includes a total of 46 miRNA genes [PMC7378193]. It has been found to be disrupted in individuals from both the New World and Australia, along with other miRNAs such as MIR519B, MIR526B, and MIR519D [PMC3938728]. In breast invasive carcinoma, the expression of MIR519C and other miRNAs from the C19MC cluster has been analyzed and associated with stem cell biology and tumorigenesis [PMC8508841]. Additionally, several microRNAs including MIR519C have been shown to affect transcription stability and protein translation [PMC10138346]. The expression of all 46 C19MC miRNA genes, including MIR519C, has been analyzed in liver hepatocellular carcinoma (HCC) using TCGA datasets [PMC7378193]. Similarly, the cumulative expression of C19MC miRNA genes has also been analyzed in breast invasive carcinoma using RNA-seq datasets [PMC6193703]. References: - [PMC3938728]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3938728/ - [PMC7378193]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7378193/ - [PMC6460512]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6460512/ - [PM10138346]: https://pubmed.ncbi.nlm.nih.gov/10138346/ - [PMC8508841]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8508841/ - [PMC6193703]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6193703/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCAGCCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAGUGCAUCUUUUUAGAGGAUUACAGUUUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications