Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-342 precursor URS00006D63BB_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-342: Mmu-mir-342 is a microRNA that has been found to be significantly correlated with over 10,000 mRNA transcripts, indicating its involvement in the liver gene regulatory network [PMC3130556]. It is also associated with NF-γ and other differentially expressed miRNAs and target genes [PMC7074395]. Mmu-mir-342, along with other miRNAs such as mmu-miR-135a, mmu-miR-135b, mmu-miR-206, and mmu-miR-144, has been shown to be related to transcription factors PBX-1 and PU.1 in various biological processes [PMC7074395] [PMC6829453]. However, further investigation is needed to understand the role of these miRNAs in the mouse thymus [PMC7074395]. Mmu-mir-342 has also been identified as one of the microRNAs involved in lymphoid development and differentially expressed between lymphocyte cell types [PMC2244641]. Additionally, it is part of the down-regulated miRNA networks associated with various mRNA networks [PMC3123543]. Overall, mmu-mir-342 plays a significant role in gene regulation and may have implications in liver function, transcriptional regulation after ovariectomy or orchiectomy, lymphoid development, and mRNA networks.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAAAUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUCAAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUGCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications