Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 78 (SNORA78) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 78 (SNORA78) URS00006D48F7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA78: SNORA78 is a small nucleolar RNA (snoRNA) that has been implicated in the tumorigenesis of non-small cell lung cancer (NSCLC) [PMC8319719]. It has been reported that SNORA78, along with SNORA47 and SNORA68, can accurately predict the overall survival of NSCLC patients [PMC6629867]. These three snoRNAs have the potential to serve as prognostic markers for NSCLC patients [PMC7140444]. In addition, SNORA78 has been shown to promote tumorigenesis in NSCLC both in vitro and in vivo [PMC8017274]. It can induce cell cycle arrest in NSCLC cells through upregulation of CDK2 [PMC8017274]. Furthermore, SNORA78 is not associated with mRNA 3′ processing complex and does not affect mRNA 3′ processing efficiency [PMC5587809]. Studies have also identified SNORA78 as part of a snoRNA-based model for predicting overall survival in lung cancer patients [PMC6629867] and as a potential marker for early detection and prognostication of NSCLC [PMC9198423]. However, it should be noted that most risk assessment models based on snoRNAs expression are not validated in clinical cases [PMC9005336].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUGGUUGAAAAUCGCCCCCGGCUUUGGCCGUGGCCGCGGGUGAGAUUCGGCGCCCAGAGCCCCCGGGGGCCUCAGCUCACCGCGCGCUGCCCCAUGUGCGGCGGUGAAACCCAGGCCCCGACAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications