Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 111 (SNORD111) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 111 (SNORD111) URS00006D333F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD111: SNORD111 is a small nucleolar RNA (snoRNA) that has been found to be up-regulated in FFPE tissues [PMC7812721]. It is one of the candidates that were further validated in a cohort of ccRCC patients and healthy donors [PMC7812721]. SNORD111 is part of a group of snoRNAs that give rise to over 90% of the processed fragments [PMC4914119]. It has been found to interact with other snoRNAs, such as snord16, snord68, and snord94, and may influence the modification of rRNA and U6 snRNA [PMC6176948]. SNORD111 has also been investigated as a potential diagnostic biomarker for NSCLC. It was found to be significantly upregulated in NSCLC patients compared to healthy donors [PMC9701848]. SNORD111 was stable and consistently measurable in plasma samples, indicating its potential as a non-invasive diagnostic marker for NSCLC [PMC9701848]. In addition, SNORD111 was found to be significantly increased in NSCLC patients compared to healthy donors when validated using TCGA data [PMC9701848]. However, the specific role and clinical significance of SNORD111 in tumors are still not well understood due to limited studies on this snoRNA [PMC9701848].\nReferences:\n- Additional file 2: Fig. (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7812721/figure/add2-10-20/)\n- PMC7812721 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7812721/)\n- PMC4914119 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4914119/)\n- PMC4282444 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4282444/)\n- PMC6176948 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6176948/)\n- PMC9701848 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9701848/)\n- PMC9644097 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9644097/)\n- PMC7720690 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7720690/)\n- PMC6124571 (https://www.ncbi.nlm.nih.gov/pmc/articles/PM

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCCUGAAAUGAUGACUCUUUAAAAAAUUUCAUGUCUCUUCUCUGACAUUUUUCUCUGGACACAGUUUUUGCCUUAUGAAUCUGAUCAGGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications