Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 23 (SNORD23) URS00006D051B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD23: SNORD23 is a snoRNA (small nucleolar RNA) that has been found to interact with U6 snRNA and is predicted to modify position 64 of U6 snRNA [PMC5389715]. It has been identified as a chimeric read with U6 snRNA [PMC5389715]. SNORD23, along with SNORA31, SNORA28, and SNORA73, has been confirmed to be significantly increased in young versus old serum [PMC5333149]. Changes in snoRNA abundance, including SNORD23, have been implicated in joint aging and osteoarthritis (OA), suggesting their potential use as biomarkers for these conditions [PMC5333149]. SNORD23 has also been identified as one of the central ncRNAs in a network topology analysis [PMC4391585]. It is one of the ncRNAs that appear in two lists of ncRNAs with high centrality [PMC4391585]. In cell differentiation, the expression of canonical snoRNAs such as SNORD23 predicts regulation of rRNA post-transcriptional modification [PMC8881200]. In different exosome populations, including A33-Exos and Ep-CAM-Exos, SNORD23 has shown differential expression levels [PMC7461500]. Additionally, it is expressed in PBMCs along with other snoRNAs such as SCARNA6 [PMC8092379]. A group of snoRNAs including SNORD23 gives rise to over 90% of the processed fragments observed [PMC4914119].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCCAGUGAUGACACCAUCCUUGCUCCCCGUGCCCCCCAGGGGCUAUGGGCGACACCAUGGCUGCCCCUGGGCUGGGCCAGUGGGGCCAAUGCCCAGGGGCUGAGGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications