Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 113-6 (SNORD113-6) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 113-6 (SNORD113-6) URS00006CC403_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD113-6: SNORD113-6 is a C/D box small nucleolar RNA that is significantly downregulated in tumor tissues compared to normal liver tissue [PMC4169825]. Inhibition of SNORD113-6 in HUAFs leads to a trend towards a decreased ratio of the ITGB3-1 mRNA over the ITGB3-2 mRNA [PMC8976432]. This can be explained by the fact that under SNORD113-6 inhibition, there is a pre-mRNA processing preference for the mRNA variant that is marked for nonsense-mediated decay (NMD) [PMC8976432]. SNORD113-6 regulates cell-cell and cell-matrix interactions as well as cell migration, which are crucial for normal fibroblast function [PMC8976432]. Inhibition of SNORD113-6 also affects fibroblast barrier function and extracellular matrix contraction [PMC8976432]. The protein expression in HUAFs is decreased under SNORD113-6 inhibition [PMC8976432]. The binding sites of SNORD113-6 are not always located in the last exon of human genes [PMC8976432]. The inhibition of SNORD113-6 alters fibroblast function and integrin signaling pathway, which plays a crucial role in fibroblast cell-cell and cell-matrix interactions [PMC8976432]. Expression of SNORD113-6 is significantly upregulated under ischemic conditions [PMC9547152]. Inhibition of SNORD113-6 affects the phenotype transition from adventitial fibroblasts to myofibroblasts [PMC9547152]. C/D box snoRNAs associate with conserved ribonucleoproteins NHP2L1, NOP56, NOP58, and Fibrillarin (FBL) [PMC9547152].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACCAGUGAUGAAUAUCAUGGGGUUUCUGAAACAACAUUUUUGAUUAAACCCAUCUGCAACUCUGAGGUCCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications