Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-498 precursor URS00006C7250_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR498: MIR498 is a miRNA gene that has been implicated in various biological processes and diseases [PMC6114234]. It has been reported that 1,25(OH)2D3, a form of vitamin D, can suppress leptin and high-fat diet-induced ovarian cancer through the MIR498 pathway [PMC6114234]. The TCGA miRNA-seq dataset of liver hepatocellular carcinoma (HCC) was used to analyze the expression of all 46 C19MC miRNA genes, including MIR498 [PMC7378193]. MIR498 has been found to have a pol III peak in CD4+ T cells but not HeLa cells [PMC2917008]. Inhibition of MIR498 has been shown to increase proliferation and decrease apoptosis, which can be reversed by silencing the EP300 gene [PMC8430307]. In esophageal cancer cells, transfection of MIR498 along with other miRNAs (MIR20b, MIR30e, and MIR196) affected both the apoptotic pathway and autophagy [PMC5302951]. Similarly, in breast invasive carcinoma cells, cumulative expression analysis revealed the presence of MIR498 along with other C19MC miRNA genes [PMC6193703]. Synthetic mimics of MIR498 have also been used to increase intracellular levels of this miRNA [PMC9276052].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCCUCCUUGGGAAGUGAAGCUCAGGCUGUGAUUUCAAGCCAGGGGGCGUUUUUCUAUAACUGGAUGAAAAGCACCUCCAGAGCUUGAAGCUCACAGUUUGAGAGCAAUCGUCUAAGGAAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications