Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000207502.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000207502.1) URS00006C4B05_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA42: SNORA42 is a small nucleolar RNA that has been implicated in various cancer-related processes. Small interfering RNAs (siRNAs) targeting SNORA42 and KIAA0907 have been designed [PMC4966663]. Silencing SNORA42 has been shown to attenuate the tumorigenicity of lung cancer cells both in vitro and in vivo [PMC8658237]. The effect of SNORA42 expression on time to relapse and cancer-specific survival has been assessed using univariate and multivariate Cox proportional hazard models [PMC4966663]. Partial alignments of human SNORA42 on chromosome 14 have been illustrated in Figure 6 [PMC2206062]. It has been found that SNORA42 functions as an oncogene in hepatocellular carcinoma (HCC) by promoting the proliferation, invasion, and metastasis of tumor cells through accelerating cell cycle progression and inhibiting apoptosis [PMC8581050]. Furthermore, specific suppression of SNORA42 in cancer cells leads to apoptosis in a p53-dependent manner [PMC4427830]. Overall, these findings suggest that targeting SNORA42 may have therapeutic potential for the treatment of various cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUGGUAGUGGGUUCAUUGGGGGCCCUUCUCUGUGGGCCUCAUAGCGUACCCAUGCCAGUGUAAACUUGAGCCUUGAACCAUUGCCCAGCCUCCUUCCCAUGGGCUGUGUGUAGCGAAGGGGGUUGCACAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications