Homo sapiens (human) microRNA hsa-mir-556 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-556 precursor URS00006C3A3C_9606

95 nucleotides
7 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
Found in 3 other species
32 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GAUAGUAAUAAGAAAGAUGAGCUCAUUGUAAUAUGAGCUUCAUUUAUACAUUUCAUAUUACCAUUAGCUCAUCUUUUUUAUUACUACCUUCAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Gorilla gorilla gorilla microRNA 556 (ENSGGOG00000029953.2)
Pan paniscus microRNA 556 (ENSPPAG00000005694.1)
Pan troglodytes (chimpanzee) ptr-mir-556 (ENSPTRG00000028036.2)

Publications