Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-517a precursor URS00006C1AF2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR517A: MIR517A is a placenta-specific miRNA that is only detected in certain types of mesenchymal stem cells (MSCs) [PMC5388876]. It has been shown that certain maternally derived miRNAs, including MIR517A, originate from the placenta, circulate in the mother's plasma, and are cleared shortly after delivery [PMC7468461]. In an individual from Tibet, MIR517A is found to be under copy number variations (CNVs) [PMC3938728]. Studies with BeWo cells have demonstrated that the syncytiotrophoblast (STB) is the main source of released MIR517A [PMC7465902]. In hepatocellular carcinoma (HCC), there are no significant differences in the expression of MIR517A between patients with and without preeclampsia (PE) [PMC4540200]. Furthermore, MIR517A expression has been detected in breast invasive carcinoma samples [PMC6193703]. It has been shown that MIR517A belongs to the C19MC cluster on chromosome 19 and has been associated with stem cell biology and tumorigenesis [PMC8508841]. In patients tested for RNA expression levels, both mir519d and MIR517A showed little to no expression, indicating correct pathological subtyping [PMC9623263]. References: - PMC5388876 - PMC7468461 - PMC3938728 - PMC7465902 - PMC4540200 - PMC6193703 - PMC8508841 - PMC9623263

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCAGGCAGUGACCCUCUAGAUGGAAGCACUGUCUGUUGUAUAAAAGAAAAGAUCGUGCAUCCCUUUAGAGUGUUACUGUUUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications