Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1275 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1275 precursor URS00006C1415_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1275: MIR1275 is a functional microRNA coding gene that has been linked to coronary atherosclerosis [PMC7123062]. It has also been directly reported to participate in multiple sclerosis (MS) [PMC6871504]. In addition, probe cg03903398 targets MIR1275, making it an effective microRNA coding gene [PMC6871504]. MIR1275 is one of the four miRNAs that were found to be downregulated in a study on T1D patients, suggesting its involvement in immune regulation and beta cell function [PMC7989380]. Another meta-analysis of studies on T1D patients also identified MIR1275 as one of the miRNAs involved in immune regulation and insulin processing, suggesting its potential as a biomarker for T1D [PMC6768498]. Furthermore, MIR1275 has been found to be negatively correlated with mitochondrial membrane potential (MMP) suppression and associated genes [PMC8327461]. It has also been reported to be dysregulated in certain types of cancer and infection [PMC5865775]. Lastly, E6 stabilizes RACK1 through O-GlcNAcylation at Ser122 and inhibits MIR1275, which inhibits the LGALS1 gene that encodes galactin1, promoting tumor invasion and metastasis [PMC10006576]. References: - PMC7123062 - PMC6871504 - PMC7989380 - PMC6768498 - PMC8327461 - PMC5865775 - PMC10006576

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCUGUGAGAAAGGGUGUGGGGGAGAGGCUGUCUUGUGUCUGUAAGUAUGCCAAACUUAUUUUCCCCAAGGCAGAGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications