Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-639 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-639 precursor URS00006BE831_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-639: Hsa-mir-639 is a microRNA that has been extensively studied in various contexts [PMC7330659]. It has been found to possess putative binding sites for hsa-miR-3664-5p, hsa-miR-4296, and hsa-mir-639 [PMC3378551]. In patients with dilated cardiomyopathy (DCM), hsa-mir-639 was observed to be downregulated compared to patients with DCM and recovered ventricular function, suggesting its potential as a diagnostic and prognostic biomarker [PMC6364251]. Hsa-mir-639 has also been found in promoter GQMs of microRNAs, indicating its involvement in gene regulation [PMC2238908]. Additionally, it was identified as part of a predictive signature for recurrence-free survival (RFS) [PMC9221286]. Hsa-mir-639 is distinctive of microvesicles (MVs) compared to exosomes (EXOs), as it was found to be present in MVs but absent in EXOs [PMC5635803]. In various cancer pathways such as breast, colorectal, pancreatic, gastric, and prostate cancer, hsa-mir-639 has been implicated as a regulator [PMC8956157]. It has also been associated with cell proliferation and cell cycle regulation by targeting CDKN1A in other diseases [PMC9761943]. Furthermore, hsa-mir-639 was found to be downregulated in adolescent and young adult (AYA) patients compared to pediatric patients [PMC9456032]. Dysregulation of hsa-mir-639 has also been observed between adenomatous and carcinoma tissue [PMC5023115]. Overall, these studies highlight the potential role of hsa-mir-639 in various biological processes and diseases [PMC5630327].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCCGACGGGGCGCGCGCGGCCUGGAGGGGCGGGGCGGACGCAGAGCCGCGUUUAGUCUAUCGCUGCGGUUGCGAGCGCUGUAGGGAGCCUGUGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications