Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-378a precursor URS00006B86A6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR378A: MIR378A is a small RNA molecule that has been found to be positively correlated with age, along with miR-34a and miR-320b, and negatively associated with age, along with miR-20a, miR-30b, miR-106b, miR-191, miR-301a, and miR-374a [PMC6196565]. The UCCU sequence of RNA has been chosen for analysis due to its presence in small RNAs such as miR23a, MIR378A, and miR344 [PMC6004406]. MIR378A has been found to be downregulated in the sperm of fathers with high paternal depressive symptoms compared to fathers without such symptoms [PMC8157381]. Additionally, MIR378A has been detected in extracellular vesicles (EVs) during the differentiation of human embryonic stem cells into cardiac cells [PMC7912193]. EVs have been shown to contain several other microRNAs (miRNAs) along with MIR378A [PMC7912193]. The levels of primary MIR378A have been determined using quantitative real-time polymerase chain reaction (qRT-PCR) along with 18 s rRNA [PMC8393456]. References: [PMC6196565] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6196565/ [PMC6004406] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6004406/ [PMC8157381] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8157381/ [PMC7912193] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7912193/ [PMC8393456] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8393456/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUAGAAAUAGCACUGGACUUGGAGUCAGAAGGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications